single guide rna (sgrna) targets  (GenScript corporation)

Journal: Journal of Extracellular Vesicles

Article Title: Identification of a Biomarker Panel in Extracellular Vesicles Derived From Non‐Small Cell Lung Cancer (NSCLC) Through Proteomic Analysis and Machine Learning

doi: 10.1002/jev2.70078

Figure Lengend Snippet: Elevated CD155 expression in EVs from NSCLC cells and patient plasma compared with healthy individuals. (A) Western blotting analysis of CD155 in EVs isolated from NSCLC and control cell lines. (B) Flow cytometry analysis of CD155 and CD63 in EVs isolated from H1975 and BEAS‐2B cells. (C) Western blotting analysis of CD155 abundance in EVs from the plasma of patients with NSCLC and healthy individuals in three independent tests. (D) Quantitative assessment of the fold change in CD155 expression from panel C, normalized to whole protein. (E) CD155 expression in EVs isolated from plasma of patients with NSCLC (LUAD, n = 20; LUSC, n = 4) and healthy individuals ( n = 16) using ELISA. (F) ROC curve analysis of the diagnostic potential of EV‐CD155 in distinguishing patients with NSCLC from healthy individuals. (G) Pearson correlation analysis of CD155 expression in EVs and tumour size in patients with NSCLC ( n = 24). (H) IHC analysis for CD155 expression in NSCLC tissue microarrays. Left: IHC staining images of paired tumour tissues (TT) and adjacent tumour tissues (ATT) ( n = 35). Right: quantitative analysis of IHC intensity for CD155 ( n = 49). T1, T2, and T3 in the quantification data refer to the tumour stages defined by the TNM classification system of NSCLC.

Article Snippet: For CD155 gene knockout (KO), a single‐guide RNA (sgRNA) targeting CD155 (human CD155 sgRNA: 5′‐CACCGCTGTTCGTCACGTTCCCGCA‐3′, 5′‐AAACTGCGGGAACGTGACGAACAGC‐3′) synthesized by Sangon Biotech (Beijing, China) and cloned into the lentiCRISPRv2 vector (Addgene, #52961).

Techniques: Expressing, Clinical Proteomics, Western Blot, Isolation, Control, Flow Cytometry, Enzyme-linked Immunosorbent Assay, Diagnostic Assay, Immunohistochemistry

Journal: Journal of Extracellular Vesicles

Article Title: Identification of a Biomarker Panel in Extracellular Vesicles Derived From Non‐Small Cell Lung Cancer (NSCLC) Through Proteomic Analysis and Machine Learning

doi: 10.1002/jev2.70078

Figure Lengend Snippet: Cellular origin and membrane localization of CD155 in EVs. (A) Immunofluorescence analysis of H1975 cells showing CD155 displayed higher co‐localization with CD63 and Rab5 than Rab7. Nuclei were stained with DAPI. Scale bars: 10 µm. (B) Quantitative analysis of Pearson's correlation coefficients demonstrating the co‐localization between CD155 with CD63, Rab5, and Rab7 in H1975 cells. (C) Western blotting analysis of cellular and EV CD155 treated with different endoglycosidases. PNGase F effectively removes the oligosaccharide chains of CD155, whereas these chains are resistant to Endo H cleavage. (D) Representative iEM images of EVs isolated from H1975 and BEAS‐2B cells. EVs were stained with anti‐CD155 antibodies. Scale bars: 100 nm. (E) Western blotting analysis of the immunocaptured EVs derived from H1975 cells using antibody against CD63 or CD155. (F) Representative iEM images of plasma EVs demonstrating CD155 localized on the EV membrane rather than within the lumen. Scale bars: 100 nm.

Article Snippet: For CD155 gene knockout (KO), a single‐guide RNA (sgRNA) targeting CD155 (human CD155 sgRNA: 5′‐CACCGCTGTTCGTCACGTTCCCGCA‐3′, 5′‐AAACTGCGGGAACGTGACGAACAGC‐3′) synthesized by Sangon Biotech (Beijing, China) and cloned into the lentiCRISPRv2 vector (Addgene, #52961).

Techniques: Membrane, Immunofluorescence, Staining, Western Blot, Isolation, Derivative Assay, Clinical Proteomics